View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13421_low_21 (Length: 231)

Name: NF13421_low_21
Description: NF13421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13421_low_21
NF13421_low_21
[»] chr5 (1 HSPs)
chr5 (75-197)||(14281672-14281794)


Alignment Details
Target: chr5 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 75 - 197
Target Start/End: Original strand, 14281672 - 14281794
Alignment:
75 ttagggttggaacagaagattgctatcttctcggcatgctggacatccccgacatgctgtcatcttctttaccaatgttgcttttgaggtaacaaactgc 174  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14281672 ttaggggtggaacagaagattgctatcttctcggcatgctggacatccccgacatgctgtcatcttctttaccaatgttgcttttgaggtaacaaactgc 14281771  T
175 ttcttgttatctcagagctactt 197  Q
    ||||||||| |||||||||||||    
14281772 ttcttgttagctcagagctactt 14281794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University