View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13422_high_3 (Length: 408)
Name: NF13422_high_3
Description: NF13422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13422_high_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 106; Significance: 6e-53; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 6e-53
Query Start/End: Original strand, 10 - 147
Target Start/End: Original strand, 45479519 - 45479656
Alignment:
| Q |
10 |
ataggtgaagttgaggaatcatacaacctgtttttgttgtaccgttttgaaggagtataaagaaagattcctaaaaaagtagcagtaggacaaatataga |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| |||||||| | |
|
|
| T |
45479519 |
ataggtgaagttgaggaatcatacaacctgtttttgttgtacagttttgaaggagtataaagaaagattcctgaaaaagtagcagtagctcaaatataaa |
45479618 |
T |
|
| Q |
110 |
atgtatggaaacgatgctctctgctgctatacttctta |
147 |
Q |
| |
|
||||||| ||| |||| ||||||||||||||||||||| |
|
|
| T |
45479619 |
atgtatgaaaaagatgatctctgctgctatacttctta |
45479656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 221 - 298
Target Start/End: Complemental strand, 1478731 - 1478654
Alignment:
| Q |
221 |
acaacttgtaaataagaggaaaaacacaactaatattataaatcctacacctacattcagacacttttacaaacacct |
298 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||||||||| |||||||| | |||||||||| | |||||||||||| |
|
|
| T |
1478731 |
acaacctgtaaataagaggaaaaacacaacaaatattataagtcctacacattcattcagacaatcttacaaacacct |
1478654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University