View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13423_low_14 (Length: 313)
Name: NF13423_low_14
Description: NF13423
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13423_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 305; Significance: 1e-172; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 305; E-Value: 1e-172
Query Start/End: Original strand, 1 - 305
Target Start/End: Original strand, 43136269 - 43136573
Alignment:
| Q |
1 |
ggaacaatcagttgataggttagagataccagctgtttcagaatttaagcctagatcacgggaatcagcgttttctgctaaaggtggtgtgtctaatagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43136269 |
ggaacaatcagttgataggttagagataccagctgtttcagaatttaagcctagatcacgggaatcagcgttttctgctaaaggtggtgtgtctaatagg |
43136368 |
T |
|
| Q |
101 |
gaaaggaagaatggtttggctgataatggtagagagcctagaaacgatcgtggtagtagatatgttaaatttgatgataagaggattgctagcaatacac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43136369 |
gaaaggaagaatggtttggctgataatggtagagagcctagaaacgatcgtggtagtagatatgttaaatttgatgataagaggattgctagcaatacac |
43136468 |
T |
|
| Q |
201 |
gctttggcaaatatggtaaatttgatgataagagaagcgctaacaacacacacgctgatagatatagtaaagttgatgataatgttgaagaaagagttga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43136469 |
gctttggcaaatatggtaaatttgatgataagagaagcgctaacaacacacacgctgatagatatagtaaagttgatgataatgttgaagaaagagttga |
43136568 |
T |
|
| Q |
301 |
tgatg |
305 |
Q |
| |
|
||||| |
|
|
| T |
43136569 |
tgatg |
43136573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University