View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13423_low_15 (Length: 299)
Name: NF13423_low_15
Description: NF13423
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13423_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 18 - 290
Target Start/End: Original strand, 51689618 - 51689890
Alignment:
| Q |
18 |
atgtcctacatatgacatatcatacgaacattctatgagtgtggttgttatgttatgatgcattaaacgtgagttataattttacattggatnnnnnnnt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
51689618 |
atgtcctacatatgacatatcatacgaacattctatgagtgtggtggttatgttgtgatgcattaaacgtgagttataattttacattggataaaaaaat |
51689717 |
T |
 |
| Q |
118 |
tgatgttgaacaatatacaagtgaaataactcataaaccaaaggcttgcaatctcatttgtatggttgttcttagttcaatgttttaaacaaaatgtttc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51689718 |
tgatgttgaacaatatacaagtgaaataactcataaaccaaaggcttgcaatctcatttgtatggttgttcttagttcaatgttttaaacaaaatgtttc |
51689817 |
T |
 |
| Q |
218 |
cttttaaatggaagtgccttcaattcactagcagagtagccaggctggatgcagtgttttctttggagtatta |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51689818 |
cttttaaatggaagtgccttcaattcactagcagagtagccaggctggatgcagtgttttctttggagtatta |
51689890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University