View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13423_low_18 (Length: 252)
Name: NF13423_low_18
Description: NF13423
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13423_low_18 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 165 - 252
Target Start/End: Original strand, 1047730 - 1047817
Alignment:
| Q |
165 |
ccacttcaacatgtaaaattctctttatgtttccttttcattgtctataaaataaattgagtcagtccattctctttatacaccaccc |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1047730 |
ccacttcaacatgtaaaattctctttatgtttccctttcattgtctataaaataaattgagtcagtccattctctttatacaccaccc |
1047817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 24 - 103
Target Start/End: Original strand, 1047587 - 1047667
Alignment:
| Q |
24 |
cttcaagccatttagaaaagaatctttggtgtgggaagtatgaataagatggataaagttttttgacc-ttggtcaatgtc |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1047587 |
cttcaagccatttagaaaagaatctttggtgtgggaagtatgaataagatggataaagttttttgacctttggtcaatgtc |
1047667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University