View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13423_low_19 (Length: 237)
Name: NF13423_low_19
Description: NF13423
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13423_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 84 - 217
Target Start/End: Complemental strand, 23939650 - 23939517
Alignment:
| Q |
84 |
tcataattgcaggtgatttgataaaataatgaatatgtagaagaatgcatggcaagaagggttttgttggttggtatagttgaggaaatatgtgatgaga |
183 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23939650 |
tcatatttgcaggtgatttgataaaatattgaatatgtagaagaatgcatggcaagaagggttttgttggttggtatagttgaggaaatatgtgatgaga |
23939551 |
T |
 |
| Q |
184 |
catttcatgttgacagaagagagagagcacaacc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
23939550 |
catttcatgttgacagaagagagagagcacaacc |
23939517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University