View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13423_low_20 (Length: 236)
Name: NF13423_low_20
Description: NF13423
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13423_low_20 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 113660 - 113447
Alignment:
| Q |
1 |
aatgacatttcagctctatactatatgcctgcagtgattgattgaagcaagataatggatagagttatgaggcagaagagatttaaatctataaacaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
113660 |
aatgacatttcagctctatactatatgcctgcagtgattgattgaagcaagataatggatagagttatgaggcagaagagatttaaatctataaacaact |
113561 |
T |
 |
| Q |
101 |
gctctcattctgactcacatgatcatcatgcaacaaacaagaagcatatgaatattagggaatgctcaaatagtagtaataagagttttattctgttctc |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
113560 |
gctctcattctgac--------tcatcatgcaacaaacaagaagcatatgaatattaggcaatgctcaaatagtagtaataagagttttattctgttctc |
113469 |
T |
 |
| Q |
201 |
agagctctctcaagacttgatg |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
113468 |
agagctctctcaagacttgatg |
113447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University