View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13424_low_13 (Length: 244)
Name: NF13424_low_13
Description: NF13424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13424_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 39 - 210
Target Start/End: Original strand, 50361315 - 50361491
Alignment:
| Q |
39 |
gcttttaagatcactgttatctctttacattaagattggtcaagttttcccctgaaaaaattggctgcccgtcaataagacatttctttcaatacac--- |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
50361315 |
gcttttaagatcactgttatctctttacattaagattggtcaagttttcccctgaaaaaattggctggccatcaataagacatttctttcaatacacacc |
50361414 |
T |
 |
| Q |
136 |
--accttccgatacaatggtggtaagaaaggcagcagctctattgtcctaactggttgcttatgagtcttttcctcc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50361415 |
ttaccttccgatacaatggtggtaagaaaggcagcagctctattgtcctaactggttgcttatgagtcttttcctcc |
50361491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University