View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13425_high_32 (Length: 289)
Name: NF13425_high_32
Description: NF13425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13425_high_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 20 - 274
Target Start/End: Original strand, 41468099 - 41468353
Alignment:
| Q |
20 |
agaaggtgtggagatgtgtctgaacgatgaaactggatgtggtctggaagatgagagtgagagtaacgagtccaaccaagttcagtgagtcgttgctcaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41468099 |
agaaggtgtggagatgtgtctgaacgatgaaactggatgtggtctggaagatgagagtgagagtaacgagtccaaccaagttcagtgagtcgttgctcaa |
41468198 |
T |
 |
| Q |
120 |
gttgagagaaggaatgaatgacttggtttgttggaagatatacaagaattcttggtcttgcacctggtgctgttgctgttcctgttcctggttctgtctt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41468199 |
gttgagagaaggaatgaatgacttggtttgttggaagatatacaagaactcttggtcttgcacctggtgctgttgctgttcctgttcctggttctgtctt |
41468298 |
T |
 |
| Q |
220 |
gtgctcaaaggattctcttgttgggttggttattaacctcaccacacctttcttg |
274 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41468299 |
gtgctcgaaggattctcttgttgggttggttattaacctcaccacacctttcttg |
41468353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University