View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13425_high_33 (Length: 279)
Name: NF13425_high_33
Description: NF13425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13425_high_33 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 16 - 266
Target Start/End: Original strand, 26823203 - 26823458
Alignment:
| Q |
16 |
cagaaaccccattattctcttcttcatcatctctttgtctcttcatggaggactccagttccaccatactctctgcagcagccattggnnnnnnnnn--- |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26823203 |
cagaaaccccattattctcttcttcatcatctctttgtctcttcatggaggactccagttccaccgtactctctgcagcagccattggaaaaaaaaaaaa |
26823302 |
T |
 |
| Q |
113 |
--taccnnnnnnnnctctctgaattattagctaaggctctgtttggctttgactggttttatgattgagaaattattggagaaatggaatagaataaagg |
210 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26823303 |
aataccttttttttttctctgaattattagctaaggctctgtttggctttgactggttttatgattgagaaattattggagaaatggaatagaataaagg |
26823402 |
T |
 |
| Q |
211 |
aaaaagggtgttgtatgggtgagactagtggaatggaaaggaatctgcttttgatg |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26823403 |
aaaaagggtgttgtatgggtgagactagtggaatggaaaggaatctgcttttgatg |
26823458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University