View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13425_high_40 (Length: 238)
Name: NF13425_high_40
Description: NF13425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13425_high_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 3202987 - 3202759
Alignment:
| Q |
1 |
aggaacatcgtaaattcatcccttccatacgattatgttggccacggaactcacacggccagcacggccgctggaaggcccgtaaaaggtgctaatgtct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3202987 |
aggaacatcgtaaattcatcccttccatacgattatgttggccacggaactcacacggccagcacggccgctggaaggcccgtgaaaggtgctaatgtct |
3202888 |
T |
 |
| Q |
101 |
ttggtaatgccaatggtactgcaattggcatggcaccatatgcacacttggcaatttacaaagtatgcggcgtctttggttgtgctgaaagtgtcatatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3202887 |
ttggtaatgccaatggtactgcaattggcatggcaccatatgcacacttggcaatttacaaagtatgcggcgtctttggttgtgctgaaagtgtcatatt |
3202788 |
T |
 |
| Q |
201 |
agctggaatggatgttgctgttgatgatg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3202787 |
agctggaatggatgttgctgttgatgatg |
3202759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 10 - 229
Target Start/End: Complemental strand, 3208952 - 3208733
Alignment:
| Q |
10 |
gtaaattcatcccttccatacgattatgttggccacggaactcacacggccagcacggccgctggaaggcccgtaaaaggtgctaatgtctttggtaatg |
109 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3208952 |
gtaaattcatcccttccatacgatgatgttggccatggaactcacacagccagcacggccgctggaaggcccgtgcaaggtgctaatgtctttggtaatg |
3208853 |
T |
 |
| Q |
110 |
ccaatggtactgcaattggcatggcaccatatgcacacttggcaatttacaaagtatgcggcgtctttggttgtgctgaaagtgtcatattagctggaat |
209 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| |||||| |||||||| |||||||||||||| |
|
|
| T |
3208852 |
ctaatggtactgcaattggcatggcaccatatgcacacttggcaatttacaaagtatgcaacatctacggttgtactgaaagttcaatattagctggaat |
3208753 |
T |
 |
| Q |
210 |
ggatgttgctgttgatgatg |
229 |
Q |
| |
|
||||| ||| |||||||||| |
|
|
| T |
3208752 |
ggatgctgcagttgatgatg |
3208733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 12 - 224
Target Start/End: Complemental strand, 3216889 - 3216677
Alignment:
| Q |
12 |
aaattcatcccttccatacgattatgttggccacggaactcacacggccagcacggccgctggaaggcccgtaaaaggtgctaatgtctttggtaatgcc |
111 |
Q |
| |
|
||||| ||| ||||||| |||| |||||||||||||||||||||||||||||||||| |||||||||| ||| | || || |||||||| || || || |
|
|
| T |
3216889 |
aaatttatctcttccattcgatgatgttggccacggaactcacacggccagcacggctgctggaaggcttgtacagggggccaatgtcttcggcaacgct |
3216790 |
T |
 |
| Q |
112 |
aatggtactgcaattggcatggcaccatatgcacacttggcaatttacaaagtatgcggcgtctttggttgtgctgaaagtgtcatattagctggaatgg |
211 |
Q |
| |
|
|| ||||| |||| |||||||||||| |||||||||||||||| |||||||||||| || | ||||||| |||| |||| | |||||| ||||||| |
|
|
| T |
3216789 |
aaaggtacggcaacaggcatggcaccagatgcacacttggcaatctacaaagtatgcagcagcagtggttgtcctgagagtgcaacattagcaggaatgg |
3216690 |
T |
 |
| Q |
212 |
atgttgctgttga |
224 |
Q |
| |
|
||| ||| ||||| |
|
|
| T |
3216689 |
atgctgcagttga |
3216677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University