View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13425_high_44 (Length: 209)

Name: NF13425_high_44
Description: NF13425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13425_high_44
NF13425_high_44
[»] chr2 (2 HSPs)
chr2 (19-76)||(45342338-45342395)
chr2 (139-190)||(45342224-45342275)


Alignment Details
Target: chr2 (Bit Score: 58; Significance: 1e-24; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 45342395 - 45342338
Alignment:
19 ggaaatgtcctagtttgtgacatttaaaacactccactatggctttgtttgcaaattg 76  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45342395 ggaaatgtcctagtttgtgacatttaaaacactccactatggctttgtttgcaaattg 45342338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 139 - 190
Target Start/End: Complemental strand, 45342275 - 45342224
Alignment:
139 cattttgatcttcatgtgaaaccttcaacgcttgctcatctctagtgtctct 190  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
45342275 cattttgatcttcatgtgaaaccttcaacgcttgctcatctctagtgtctct 45342224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University