View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13425_low_16 (Length: 483)
Name: NF13425_low_16
Description: NF13425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13425_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 364; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 364; E-Value: 0
Query Start/End: Original strand, 92 - 467
Target Start/End: Complemental strand, 18217407 - 18217032
Alignment:
| Q |
92 |
tcacatttttcttcttggtgacaaaatccaaaggagcatcatcattattcccaaaatctttggctccattcaagctaagtctcccttttgaattcagatt |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18217407 |
tcacatttttcttcttggtgacaaaatccaaaggggcatcatcattattcccaaaatctttggctccattcaagctaagtctcccttttgaattcagatt |
18217308 |
T |
 |
| Q |
192 |
agatggattaaaatcatgtggagcaatcattcccgccgttacagagggccccacttgccaaacatggttaatggcggtaacatcaaccggaaccttaacg |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
18217307 |
agatggattaaaatcatgtggagcaatcattcccgccgttacagagggccccacttgccaaacatggttaatggcggtaacattaaccggaaccttaacg |
18217208 |
T |
 |
| Q |
292 |
gtagcaaaaatcttcattaaaccaccagcttcctcggctttcatatcccaaacatcaaaagaaagcttcccaggaataaaaaccttgtaagatttaaggt |
391 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18217207 |
gtagcaaaaatcttcattaaaccaccatcttcctcggctttcatatcccaaacatcaaaagaaagcttcccaggaataaaaaccttgtaagatttaaggt |
18217108 |
T |
 |
| Q |
392 |
ccaatgtcttcatcgccatcacaccgttgtttttaaatgccacaatcacctgcgccccgaccattcctgtggcggt |
467 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18217107 |
ccaatgtcttcatcgccatcacaccgttgtttttaaatgccacaatcacctgcgccccgaccattcctgtggcggt |
18217032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University