View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13425_low_43 (Length: 245)
Name: NF13425_low_43
Description: NF13425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13425_low_43 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 8e-79; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 65 - 227
Target Start/End: Original strand, 51770789 - 51770948
Alignment:
| Q |
65 |
gcctggcttcaacctgtctgccttaatggacgcaaatgcaatggtacgatgtcaatgtctgatgagcaacgaggttgttgttggatttgcaaagagaacc |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51770789 |
gcctggcttcaacctgtctgccttaatggacgcaaatgcaatggtacgatgtcaatgtctgatgagcaacgaggttgttgttggatttgcaaagagaacc |
51770888 |
T |
|
| Q |
165 |
accacctgtttgtgagcaagggtataagggtcattgcatgttgctgctagtactactactact |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
51770889 |
accacctgtttgtgagcaagggtataagggtcattgca---tgctgctagtactactactact |
51770948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 51770734 - 51770767
Alignment:
| Q |
1 |
tggtgaaatgaatgaatgaaagaaaaggtagtaa |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
51770734 |
tggtgaaatgaatgaatgaaagaaaaggtagtaa |
51770767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University