View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13425_low_52 (Length: 211)
Name: NF13425_low_52
Description: NF13425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13425_low_52 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 90 - 195
Target Start/End: Complemental strand, 44623767 - 44623662
Alignment:
| Q |
90 |
tcttttttcgatttagcattacctttcttacctttctttttcacgggtttctcttccaccgcaaccggaaccgcatcctcagacacttccactccgatag |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
44623767 |
tcttttttcgatttagcattacctttcttacctttctttttcacgggtttctcttccaccgcaaccggaatcgcatcctcagacacttccactccgatag |
44623668 |
T |
|
| Q |
190 |
aatatt |
195 |
Q |
| |
|
|||||| |
|
|
| T |
44623667 |
aatatt |
44623662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University