View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13425_low_53 (Length: 209)
Name: NF13425_low_53
Description: NF13425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13425_low_53 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 58; Significance: 1e-24; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 45342395 - 45342338
Alignment:
| Q |
19 |
ggaaatgtcctagtttgtgacatttaaaacactccactatggctttgtttgcaaattg |
76 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45342395 |
ggaaatgtcctagtttgtgacatttaaaacactccactatggctttgtttgcaaattg |
45342338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 139 - 190
Target Start/End: Complemental strand, 45342275 - 45342224
Alignment:
| Q |
139 |
cattttgatcttcatgtgaaaccttcaacgcttgctcatctctagtgtctct |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45342275 |
cattttgatcttcatgtgaaaccttcaacgcttgctcatctctagtgtctct |
45342224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University