View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13425_low_7 (Length: 587)
Name: NF13425_low_7
Description: NF13425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13425_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 5e-82; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 5e-82
Query Start/End: Original strand, 400 - 570
Target Start/End: Complemental strand, 9475577 - 9475407
Alignment:
| Q |
400 |
ttcactggcttgctacagttcaagtaaattatgtattcgaaccaagatgcataatcaaatctgtatggatcctcgcggctgctattactgtaataacttg |
499 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9475577 |
ttcactggcttgctacagttcaagtaagttatgtattcgaaccaagatgcataatcaaatccgtatggatcctcgcgtttgctattactgtaataacttg |
9475478 |
T |
 |
| Q |
500 |
tgaaattggatttggttaagaaataacgaggaatggagaagcaatcatcctcttgaattccaggatcaact |
570 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9475477 |
tgaaattggatttggttaagaaataacgaggaatggagaagcaatcatcctcttgaattccaggatcaact |
9475407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 489 - 570
Target Start/End: Complemental strand, 9307031 - 9306950
Alignment:
| Q |
489 |
gtaataacttgtgaaattggatttggttaagaaataacgaggaatggagaagcaatcatcctcttgaattccaggatcaact |
570 |
Q |
| |
|
|||| ||||||||||||||| | |||||||||||| ||||| |||||| |||||||| | |||||||||||| |||||||| |
|
|
| T |
9307031 |
gtaagaacttgtgaaattggctgcggttaagaaatagcgaggcatggaggagcaatcaccttcttgaattccaagatcaact |
9306950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 570
Target Start/End: Original strand, 9359214 - 9359290
Alignment:
| Q |
494 |
aacttgtgaaattggatttggttaagaaataacgaggaatggagaagcaatcatcctcttgaattccaggatcaact |
570 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||| |||||| | |||||| |||| | ||||||||| |
|
|
| T |
9359214 |
aacttgtgaaattggatttagttaagaaatatggaggaatggaggagcaattaccctcttcaattactggatcaact |
9359290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 489 - 554
Target Start/End: Complemental strand, 15912979 - 15912914
Alignment:
| Q |
489 |
gtaataacttgtgaaattggatttggttaagaaataacgaggaatggagaagcaatcatcctcttg |
554 |
Q |
| |
|
|||| |||||| ||| |||||| |||||||||| ||||||||||||||| |||||||| ||||||| |
|
|
| T |
15912979 |
gtaaaaacttgagaagttggatgtggttaagaagtaacgaggaatggaggagcaatcaccctcttg |
15912914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 486 - 570
Target Start/End: Original strand, 9168363 - 9168444
Alignment:
| Q |
486 |
actgtaataacttgtgaaattggatttggttaagaaataacgaggaatggagaagcaatcatcctcttgaattccaggatcaact |
570 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||| |||||||||| ||||||| | |||| ||||||||||||||| |
|
|
| T |
9168363 |
actgtaataacttgtgaaattggttgcggttaagaaatagcgaggaatgg---tgcaatcaccttcttctattccaggatcaact |
9168444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University