View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13426_high_5 (Length: 240)
Name: NF13426_high_5
Description: NF13426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13426_high_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 12 - 210
Target Start/End: Complemental strand, 11248789 - 11248578
Alignment:
| Q |
12 |
tcatcaaacaaagaatgacaatcaattaaaacaagaaaattt-gactaagagaattccaggttggacctaattggaaaaagatgaaaatttgaatgaaag |
110 |
Q |
| |
|
|||||||| | |||||| ||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11248789 |
tcatcaaatatagaatggcaatcaattaaaacaagaagattttgactaagagaattccaggttggacctaattggaaaaagatgaaaatttgaatgaaag |
11248690 |
T |
|
| Q |
111 |
taaa------------agttgaagatttacggttgcttggggaaaacatgttttgtttttgttctctttatgtgttagtttggtttgattggttccttgc |
198 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11248689 |
taaagtgaaattgaaaagttgaagatttacagttgcttggggaaaacatgttttgtttttgttctctttatgtgttagtttggtttgattggttccttgc |
11248590 |
T |
|
| Q |
199 |
ttaatttggatg |
210 |
Q |
| |
|
|||||||||||| |
|
|
| T |
11248589 |
ttaatttggatg |
11248578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University