View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13426_low_15 (Length: 205)

Name: NF13426_low_15
Description: NF13426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13426_low_15
NF13426_low_15
[»] chr8 (1 HSPs)
chr8 (17-190)||(34087466-34087638)


Alignment Details
Target: chr8 (Bit Score: 144; Significance: 6e-76; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 144; E-Value: 6e-76
Query Start/End: Original strand, 17 - 190
Target Start/End: Complemental strand, 34087638 - 34087466
Alignment:
17 acttttgatgtcggg-ttaccttttcacaataaaaattaagaaaacttaactcttgctggtatttgatttaagttgacagtttggattttaatgcattta 115  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34087638 acttttgatgtcggggttaccttttcacaataaaaattaagaaaacttaactcttgctggtatttgatttaagttgacagtttggattttaatgcattta 34087539  T
116 aactgtatttgtttcttcatgagcgagcatagtatgaatccacgattcaacacaaaataatccactgtcgttcat 190  Q
    |||||||||| |||||||| ||||||||||| |||||||||||||||||||||  ||||||||||||||||||||    
34087538 aactgtatttatttcttcacgagcgagcatattatgaatccacgattcaacac--aataatccactgtcgttcat 34087466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University