View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13426_low_15 (Length: 205)
Name: NF13426_low_15
Description: NF13426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13426_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 144; Significance: 6e-76; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 144; E-Value: 6e-76
Query Start/End: Original strand, 17 - 190
Target Start/End: Complemental strand, 34087638 - 34087466
Alignment:
| Q |
17 |
acttttgatgtcggg-ttaccttttcacaataaaaattaagaaaacttaactcttgctggtatttgatttaagttgacagtttggattttaatgcattta |
115 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34087638 |
acttttgatgtcggggttaccttttcacaataaaaattaagaaaacttaactcttgctggtatttgatttaagttgacagtttggattttaatgcattta |
34087539 |
T |
|
| Q |
116 |
aactgtatttgtttcttcatgagcgagcatagtatgaatccacgattcaacacaaaataatccactgtcgttcat |
190 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34087538 |
aactgtatttatttcttcacgagcgagcatattatgaatccacgattcaacac--aataatccactgtcgttcat |
34087466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University