View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13427_high_26 (Length: 253)
Name: NF13427_high_26
Description: NF13427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13427_high_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 8 - 148
Target Start/End: Original strand, 43299011 - 43299151
Alignment:
| Q |
8 |
agagaagaaaaataatcaaaatgttaaaaatgacttacctgttgtgcaactgtatcatctggatgtacataatactgtctgtagaaacataaattaacca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43299011 |
agagaagaaaaataatcaaaatgttaaaaatgacttacctgttgtgcaactgtatcatctggatgtacataatactgtctgtagaaacataaattaacca |
43299110 |
T |
|
| Q |
108 |
acttaagcactgaataaaaattgttatggtaaacaaacaca |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43299111 |
acttaagcactgaataaaaattgttatggtaaacaaacaca |
43299151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University