View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13427_low_17 (Length: 379)
Name: NF13427_low_17
Description: NF13427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13427_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 95; Significance: 2e-46; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 241 - 355
Target Start/End: Original strand, 32101997 - 32102111
Alignment:
| Q |
241 |
ggaccgacggcttaaagaaagaaatgatcaacagtataagagaagagcttgaagagaaatggccatccttgaaaaagggtgtcacagatttttctttttg |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32101997 |
ggaccgacggcttaaagaaagaaatgatcagaagtataagagaagagcttgaagagaaatgaccatccttgaaaaagggtgtcacagatttgtctttttg |
32102096 |
T |
 |
| Q |
341 |
gcaacacgagtggaa |
355 |
Q |
| |
|
|||||| |||||||| |
|
|
| T |
32102097 |
gcaacatgagtggaa |
32102111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 171 - 355
Target Start/End: Complemental strand, 35726610 - 35726425
Alignment:
| Q |
171 |
ccgtgtggttgagaataaattctcaatccacggcctccggccagata-aaaatctcatcaacatgtctgcaggaccgacggcttaaagaaagaaatgatc |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| ||| |||| |||| ||| || ||| |||| | | ||| ||||| | || ||||||| |
|
|
| T |
35726610 |
ccgtgtggttgagaataaattctcaatccagggcctctggctggatataaaacctcctctacaacactgctaaatcaacgacttaagggaaagaatgatc |
35726511 |
T |
 |
| Q |
270 |
aacagtataagagaagagcttgaagagaaatggccatccttgaaaaagggtgtcacagatttttctttttggcaacacgagtggaa |
355 |
Q |
| |
|
| |||||||| |||||||||||||||||| | ||||||| |||||| | ||||||||| ||||||| |||||||||||||| |
|
|
| T |
35726510 |
agaggtataagaaaagagcttgaagagaaattgtcatccttagaaaaggataccacagatttgcctttttgccaacacgagtggaa |
35726425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University