View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13427_low_30 (Length: 251)
Name: NF13427_low_30
Description: NF13427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13427_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 13 - 223
Target Start/End: Original strand, 4389231 - 4389442
Alignment:
| Q |
13 |
aatatggaacttgttattgataagataggaaagattgatcatgtagaggtggagaaagggttatctatggagtcggctagagttttggttcacacaaaac |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4389231 |
aatatggaacttgttattgataagataggaaagattgatcatgtagaggtggagaaagggttatctatggagtcagctagagttttggttcacacaaaac |
4389330 |
T |
 |
| Q |
113 |
tcatgccattcattgaagatcgattctttatggtgtgatg-catttgctgtctcgagaaagtgataaggatagcctatgaagtatgttgaaagttgaaaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4389331 |
tcatgccattcattgaagatcgattctttatggtgtgatgccatttgctgtctcgagaaagtgataaggatagcctatgaagtatgttgaaagttgaaaa |
4389430 |
T |
 |
| Q |
212 |
tgcttctgcaaa |
223 |
Q |
| |
|
|||||||||||| |
|
|
| T |
4389431 |
tgcttctgcaaa |
4389442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University