View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13427_low_33 (Length: 227)

Name: NF13427_low_33
Description: NF13427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13427_low_33
NF13427_low_33
[»] chr8 (1 HSPs)
chr8 (97-188)||(43102970-43103061)


Alignment Details
Target: chr8 (Bit Score: 72; Significance: 7e-33; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 97 - 188
Target Start/End: Complemental strand, 43103061 - 43102970
Alignment:
97 taagtgaccacacgaaaccaaatacatgttccttttcaaccatcatggaagaaatgaaatccctaatgatccttgttttcccaatagccata 188  Q
    |||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| ||||||||||||    
43103061 taagtgactacaccaaaccaaatacatgttccttttcaaccatcatggaagaaatgaaatccctaatgatgcttgcttttccaatagccata 43102970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University