View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13427_low_34 (Length: 222)
Name: NF13427_low_34
Description: NF13427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13427_low_34 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 29339877 - 29340080
Alignment:
| Q |
1 |
ttcaaccttgcattggccaaataataaattgtgaaattggaatgaaaagtactttctaaagataa---tatacacaattggatgctgcatcatgcttttg |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29339877 |
ttcaaccttgcattggccaaataataaattgtgaaattggaatgaaaagtactttctaaagataataatatacacaattggatgctgcatcatgcttttg |
29339976 |
T |
|
| Q |
98 |
ggttgaaaacttgaaatgaaacagccgaagttaaacaatattttaagggtgcattagaggcttaagcatatatttaaagggggttagttttttatagaca |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29339977 |
ggttgaaaacttgaaatgaaacagccgaagttaaacaatattttaagggtgcattagaggcttaagcatatatttaaagggggttagttttttatagaca |
29340076 |
T |
|
| Q |
198 |
cata |
201 |
Q |
| |
|
|||| |
|
|
| T |
29340077 |
cata |
29340080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University