View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13427_low_8 (Length: 564)
Name: NF13427_low_8
Description: NF13427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13427_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 524; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 524; E-Value: 0
Query Start/End: Original strand, 18 - 557
Target Start/End: Original strand, 30804485 - 30805024
Alignment:
| Q |
18 |
cgattaaatctgcgtctttctactacaagactggtatgttatggcataacctccggaaattcgatctcgccgcgaaatgctacgaacgagccactgatct |
117 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30804485 |
cgattaaatcagcgtcgttctactacaagactggtatgttatggcataacctccggaaattcgatctcgccgcgaaatgctacgaacgagccactgatct |
30804584 |
T |
|
| Q |
118 |
ggtttcaaaactcgatatagcttcgataacagacaccggagagagaaaactgcttttagatctgaatttggctcggtcccgaacagcttgggaggttcgg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30804585 |
ggtttcaaaactcgatatagcttcgataacagacgccggagagagaaaactgcttttagatctgaatttggctcggtcccgaacagcttgggaggttcgg |
30804684 |
T |
|
| Q |
218 |
gatcagaaccttgctattgcgttactgaaccgaagcaaaagcatggtttctggttcgagtgagaattacatggaactagcgaagcagtttatgtcgttcg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30804685 |
gatcagaaccttgctattgcgttactgaaccgaagcaaaagcatggtttctggttcgagtgagaattacatggaactagcgaagcagtttatgtcgttcg |
30804784 |
T |
|
| Q |
318 |
ggaaatgttccctcgccgcgaacagtgatttgagcgaggcgttgaagttgatgaacgaggcgttggagaattgtgagaagggattcggtgcagcgaggac |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30804785 |
ggaaatgttccctcgccgcgaacagtgatttgagcgaggcgttgaagttgatgaacgaggcgttggagaattgtgagaagggattcggtgcagcgaggac |
30804884 |
T |
|
| Q |
418 |
acgggaagagaaggtggagattcgaggtttgaggtggaaggttttgaggtttatagcggcgattcatttgcagaaagaggaatttgagagtgtggttaag |
517 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30804885 |
acgggaagagaaggtggagattcgaggtttgaggtggaaggttttgaggtttatagcggcgattcatttgcagaaagaggaatttgagagtgtggttaag |
30804984 |
T |
|
| Q |
518 |
tgtgtgaaggttttgagagattctgctgaaggtgatgatg |
557 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30804985 |
tgtgtgaaggttttgagagattctgctgaaggtggtgatg |
30805024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University