View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13428_high_2 (Length: 270)
Name: NF13428_high_2
Description: NF13428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13428_high_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 3e-54; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 18 - 125
Target Start/End: Complemental strand, 34637928 - 34637821
Alignment:
| Q |
18 |
caacctgtgcgtaattgggatatttcaatattaaagggcttcatgaaatatagaagaataattttttataatttatttatcctggatcgtttaatcggta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34637928 |
caacctgtgcgtaattgggatatttcaatattaaagggcttcatgaaatatagaagaataattttttataatttatttatcctggatcgtttaatcggta |
34637829 |
T |
|
| Q |
118 |
ctattttt |
125 |
Q |
| |
|
|||||||| |
|
|
| T |
34637828 |
ctattttt |
34637821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University