View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13429_high_20 (Length: 272)
Name: NF13429_high_20
Description: NF13429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13429_high_20 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 272
Target Start/End: Complemental strand, 41125628 - 41125359
Alignment:
| Q |
1 |
tcatcaccattatgattagataattgaaaatgtttggctttacctataactgcttttaaagtcaaacacatcagcggttttgatttgtcgacagtgtatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41125628 |
tcatcaccattatgattagataattgaaaatgtttggctttacctataactgcttttaaagtcaaacaaatcagcggttttgatttgtcgacagtgtatg |
41125529 |
T |
 |
| Q |
101 |
aaaattaatctctgaaaagcatgtctggnnnnnnnnnnnnnnnattgaatgttgtttgtagctcttatgggtttaagccttcacaaaaggatttactgga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41125528 |
aaaattaatctctgaaaagcatgtctggtgttttttttttt--attgaatgttgtttgtagctcttatgggtttaagccttcacaaaaggatttactgga |
41125431 |
T |
 |
| Q |
201 |
tcatatgtctctgattggtgaagctactacaagagatgtgggcttagctaattctaaggtttgtattttctt |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41125430 |
tcatatgtctctgattggtgaagctactacaagagatgttggcttagctaattctaaggtttgtattttctt |
41125359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University