View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13429_high_22 (Length: 254)
Name: NF13429_high_22
Description: NF13429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13429_high_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 21 - 245
Target Start/End: Original strand, 41124798 - 41125024
Alignment:
| Q |
21 |
atagcctccttcagattgaatnnnnnnntgaggccaagttatttagtttcgtgtattcatcctctcccactcaaataacaatgtaaaccaatgcttttga |
120 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41124798 |
atagcctccttcagattgaataaaaaaatgaggccaagttatttagtttcgtgtattcatcctctcccactcaaataacaatgtaaaccaatgcttttga |
41124897 |
T |
|
| Q |
121 |
catactaccagtaacaacac--aaattaccgataaagacctgtcggaagtctattgagtcttgccagacaccatcccattcaaaattcaaaaaactactt |
218 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41124898 |
catactaccagtaaccacacacaaattaccgataaagacccgtcggaagtctattgagtcttgccagacaccatcccattcaaaattcaaaaaactactt |
41124997 |
T |
|
| Q |
219 |
aaatatgcagtgctcgtttgcctatga |
245 |
Q |
| |
|
|||||||||||| |||||||||||||| |
|
|
| T |
41124998 |
aaatatgcagtggtcgtttgcctatga |
41125024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University