View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13429_high_28 (Length: 207)
Name: NF13429_high_28
Description: NF13429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13429_high_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 16 - 191
Target Start/End: Complemental strand, 30409872 - 30409696
Alignment:
| Q |
16 |
aagaatatgcaatataagatatgt-gcctacggtggctcagcgagccaccttccttttcggtggtttccctctcgagcgtggttcaacctttgtatgtcg |
114 |
Q |
| |
|
||||| |||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30409872 |
aagaaaatgcaatataagatatgttgcctatggtggctcagcgagccaacttccttttcggtggtttccctctcgagcgtggttcaacctttgtatgtcg |
30409773 |
T |
|
| Q |
115 |
tctaattcaagatatgtccccgttggcaaggatcattttggttgtattggatttggttttatggttcgttagaactg |
191 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30409772 |
tctaattcaagatatgtcgccgttggcaaggatcattttggttgtattggatttggttttatggttcgttagaactg |
30409696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University