View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13429_low_15 (Length: 397)
Name: NF13429_low_15
Description: NF13429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13429_low_15 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 370; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 370; E-Value: 0
Query Start/End: Original strand, 17 - 397
Target Start/End: Complemental strand, 41125382 - 41125001
Alignment:
| Q |
17 |
taattctaaggtttgtattttctttctcaaagatattgtgattttgaactaggtgactaaaatttaatcattcaaaatatggtttgcctgagattcaaat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41125382 |
taattctaaggtttgtattttctttctcaaagatattgtgattttgaactaggtgactaaaatttaatcattcaaaatatggtttgcctgagattcaaat |
41125283 |
T |
|
| Q |
117 |
tgtacttgtgttt-aattttttattatagaagttaacttttgctataagttaattaattgctatgaatttgaaattttcattttccttaagcggtgtttg |
215 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41125282 |
tgtacttgtgttttaattttttattatagaagttaacttttgctataagttaattaattgctatgaatttgaaattttcattttccttaagcggtgtttg |
41125183 |
T |
|
| Q |
216 |
tgtgcggtttggagcaaagaaaattttgattatctgtttttgtaaaccatctgtgtttgtttttggcttattgtcttggttttcgaggtacaaaatcagc |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41125182 |
tgtgcggtttggagcaaagaaaattttgattatctgtttttgtaaaccatctgtgtttgtttttggcttattgtcttggttttcgaggtacaaaatcagc |
41125083 |
T |
|
| Q |
316 |
aatgatatggttctactttataatattctttgatgagttgaaatatatgattttagtttcataggcaaacgagcactgcata |
397 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
41125082 |
aatgatatggttctactttataatattctttgatgagttgaaatatatgattttagtttcataggcaaacgaccactgcata |
41125001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University