View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13429_low_21 (Length: 277)
Name: NF13429_low_21
Description: NF13429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13429_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 260
Target Start/End: Original strand, 27066354 - 27066613
Alignment:
| Q |
1 |
gttcaaattcttgctatagcttacgaaagcatctacagcgcttgagcctttttctgaatatccagagaaatcagatttgaagacgttagcatttttcgca |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27066354 |
gttcaaattcttactatagcttacgaaagcatctacagcgcttgagcctttttctgaatatccagagaaatcagatttgaagacgttagcatttttcgca |
27066453 |
T |
 |
| Q |
101 |
tactgagtgaaaccgttaactgcgtgaatagagtctttgccgtaacttgcgaaactttggttaccggagttaccaccatcgctgtagcttacgaatgatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27066454 |
tactgagtgaaaccgttaactgcgtgaatagagtctttgccgtaacttgcgaaactttggttaccggagttaccaccatcgctgtagcttacgaatgatt |
27066553 |
T |
 |
| Q |
201 |
gttctcttccggtcacggaggctgtgtaggtggtgaattttacgttaggaatgttgcttt |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27066554 |
gttctcttccggtcacggaggctgtgtaggtggtgaattttaggttaggaatgttgcttt |
27066613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University