View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13429_low_29 (Length: 237)
Name: NF13429_low_29
Description: NF13429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13429_low_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 29681660 - 29681880
Alignment:
| Q |
1 |
tggaaggaggtcctttttaggtggtgttgttttttgcttcataatgttgttttgcaggaaagtgtagttgaccgttggaagtggtctcttgatccagtta |
100 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29681660 |
tggaaggaggacctttttaggtgttgttgttttttgcttcataatgttgttttgcaggaaagtgtagttgaccgttggaagtggtctcttgatccagtta |
29681759 |
T |
 |
| Q |
101 |
aaggctactctatcggcgatgcatatcagatgttcacagcaacagaccagaatcctaacagggctaacatgtataccatatgtcataaacaacttcctct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29681760 |
aaggctactctatcggcgatgcatatcagatgttcacagcaacagaccaaaatcctaacagggctaacatgtataccatatgtcataaacaacttcctct |
29681859 |
T |
 |
| Q |
201 |
caaggtctctttatttgtgtg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
29681860 |
caaggtctctttatttgtgtg |
29681880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University