View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13429_low_30 (Length: 234)
Name: NF13429_low_30
Description: NF13429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13429_low_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 19 - 231
Target Start/End: Complemental strand, 3714903 - 3714690
Alignment:
| Q |
19 |
acgaagatgggtttctgtatgttacatacagcggacgaaaacaccttt-ggagaacttatttcccacattcactagcagtcataatgaatgtatactgtt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3714903 |
acgaagatgggtttctgtatgttacatacagcggacgaaaacaccttttggagaacttatttcccacattcactagcagtcataatgaatgtatactgtt |
3714804 |
T |
|
| Q |
118 |
tgatccgatctcgttggtttgtctgataaattctttgtagtctgtactgtagtactcattcaagaaccatactctcaatgttatgtttactcttcgaact |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
3714803 |
tgatccgatctcgttggtttgtctgataaattctttgtagtctgtactgtagtactcattcaagaaccatactctcaatgttatgttcactctttgaact |
3714704 |
T |
|
| Q |
218 |
cttttacctctgtt |
231 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
3714703 |
cttttacctgtgtt |
3714690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University