View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13429_low_31 (Length: 230)
Name: NF13429_low_31
Description: NF13429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13429_low_31 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 17 - 83
Target Start/End: Complemental strand, 26496206 - 26496140
Alignment:
| Q |
17 |
atcatcattctacaataccttcaaaacaacaaagaaaaacacttccattctattcatatcatatttt |
83 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
26496206 |
atcatcattctacaataccttcaaaacaacaaagaaaaacacttccattctattcatatcttatttt |
26496140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 162 - 203
Target Start/End: Complemental strand, 26496061 - 26496020
Alignment:
| Q |
162 |
ttgatcctattctatagctatatcttctcttacgttcttttt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26496061 |
ttgatcctattctatagctatatcttctcttacgttcttttt |
26496020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University