View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13429_low_32 (Length: 207)

Name: NF13429_low_32
Description: NF13429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13429_low_32
NF13429_low_32
[»] chr4 (1 HSPs)
chr4 (16-191)||(30409696-30409872)


Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 16 - 191
Target Start/End: Complemental strand, 30409872 - 30409696
Alignment:
16 aagaatatgcaatataagatatgt-gcctacggtggctcagcgagccaccttccttttcggtggtttccctctcgagcgtggttcaacctttgtatgtcg 114  Q
    ||||| |||||||||||||||||| ||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
30409872 aagaaaatgcaatataagatatgttgcctatggtggctcagcgagccaacttccttttcggtggtttccctctcgagcgtggttcaacctttgtatgtcg 30409773  T
115 tctaattcaagatatgtccccgttggcaaggatcattttggttgtattggatttggttttatggttcgttagaactg 191  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30409772 tctaattcaagatatgtcgccgttggcaaggatcattttggttgtattggatttggttttatggttcgttagaactg 30409696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University