View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1342_high_13 (Length: 545)

Name: NF1342_high_13
Description: NF1342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1342_high_13
NF1342_high_13
[»] chr4 (2 HSPs)
chr4 (379-516)||(196339-196476)
chr4 (232-278)||(196577-196623)
[»] chr2 (1 HSPs)
chr2 (43-76)||(29171716-29171749)


Alignment Details
Target: chr4 (Bit Score: 134; Significance: 2e-69; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 134; E-Value: 2e-69
Query Start/End: Original strand, 379 - 516
Target Start/End: Complemental strand, 196476 - 196339
Alignment:
379 ccaaacatgcctaagatgtaggtaggggtgaagagagaacatggtcaaggcagagtacaatattcttttaatggaaatgaatgctgcaaatagaaatctt 478  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
196476 ccaaacatgcctaagatgtaggtaggagtgaagagagaacatggtcaaggcagagtacaatattcttttaatggaaatgaatgctgcaaatagaaatctt 196377  T
479 agtacggtatacgatgattaatcatttaggggtgagtc 516  Q
    ||||||||||||||||||||||||||||||||||||||    
196376 agtacggtatacgatgattaatcatttaggggtgagtc 196339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 232 - 278
Target Start/End: Complemental strand, 196623 - 196577
Alignment:
232 tgatagtcaaaattactaaacaaattcagtttgattgttttctttct 278  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||    
196623 tgatagtcaaaattacgaaacaaattcagtttgattgttttctttct 196577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 43 - 76
Target Start/End: Complemental strand, 29171749 - 29171716
Alignment:
43 atttttatatttgacataattcatctttacaaaa 76  Q
    |||||||||||||||||||||||||||| |||||    
29171749 atttttatatttgacataattcatctttccaaaa 29171716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University