View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1342_high_25 (Length: 383)
Name: NF1342_high_25
Description: NF1342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1342_high_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 155 - 355
Target Start/End: Original strand, 40892098 - 40892298
Alignment:
| Q |
155 |
attagagaaagagaacataagagatcctccttgctgcttttctggtttgtgccttggtggtttgattgcaacagcagaaggtgtcatgttggtttgatgg |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40892098 |
attagagaaagagaacataagagatcctccttgctgcttttctggtttgtgccttggtagtttgattgcaacagcagaaggtgtcatgttggtttgatgg |
40892197 |
T |
 |
| Q |
255 |
ctggtttgtttcattgaagtagctcactaagtggagtgtagtttatcattgccaattttattgcagagtagcagtttcattatttatgtgttgctttatt |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40892198 |
ctggtttgtttcattgaagtagctcactaagtggagtgtagtttatcattgccaattttattgcagagtagcagtttcattatttatgtgttgctttatt |
40892297 |
T |
 |
| Q |
355 |
t |
355 |
Q |
| |
|
| |
|
|
| T |
40892298 |
t |
40892298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 171; E-Value: 1e-91
Query Start/End: Original strand, 155 - 355
Target Start/End: Original strand, 44143541 - 44143738
Alignment:
| Q |
155 |
attagagaaagagaacataagagatcctccttgctgcttttctggtttgtgccttggtggtttgattgcaacagcagaaggtgtcatgttggtttgatgg |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44143541 |
attagagaaagagaacataagagatcctccgtgctgcttttctggtttgtgccttggtggtttgattgcaacagcagaaggtgtcatgttggtttgatgg |
44143640 |
T |
 |
| Q |
255 |
ctggtttgtttcattgaagtagctcactaagtggagtgtagtttatcattgccaattttattgcagagtagcagtttcattatttatgtgttgctttatt |
354 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
44143641 |
ctggtttgtttcattgaagtagctcactaagtggagtatggtttatcattgccaattttattacagagtagcagtttcattat---tgtgttgctttatt |
44143737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 125; E-Value: 3e-64
Query Start/End: Original strand, 13 - 157
Target Start/End: Original strand, 44140674 - 44140818
Alignment:
| Q |
13 |
aatatatcactggactgaattcatgtgtcgacttttggaatggatcccacatatggaatcagaccgatagtattaaggggacccacataaatatgaccaa |
112 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
44140674 |
aatatattactggactgaattcatgtgtcgacttttggaatggatcccacatatggaatcagaccgatattattaaggggacccacataaatacgaccaa |
44140773 |
T |
 |
| Q |
113 |
acaatattgtgttactagtattatttgttatcatttattcgtatt |
157 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44140774 |
acaaaattgcgttactagtattatttgttatcatttattcgtatt |
44140818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University