View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1342_high_26 (Length: 377)
Name: NF1342_high_26
Description: NF1342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1342_high_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 11 - 226
Target Start/End: Original strand, 42699442 - 42699657
Alignment:
| Q |
11 |
caaagggttttccagttctgctgcaaaataagaaacagcagctgtaacaaagatgggtgatgactttaagatcgtgaaacgcaagctcactctctaccac |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42699442 |
caaagggttttccagttctgctgcaaaataagaaacagcagctgtgacaaagatgggtgatgactttaagatcgtgaaacgcaagctcactctctaccac |
42699541 |
T |
 |
| Q |
111 |
tctcagaacgacactgtttcaactctaccagttcctgaaactaatgccgagaatatattgctattgccagaattgccgaaagaactcatcgacgagatcc |
210 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
42699542 |
tctcagaacgatactgtttcaactctaccggttcctgaaactaatgccgagaatatattgctattgccagaattgccgaaagaactcatcgacgagattc |
42699641 |
T |
 |
| Q |
211 |
ttgcaagacttcctgt |
226 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
42699642 |
ttgcaagacttcctgt |
42699657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University