View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1342_high_41 (Length: 307)
Name: NF1342_high_41
Description: NF1342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1342_high_41 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 29 - 299
Target Start/End: Complemental strand, 23917512 - 23917242
Alignment:
| Q |
29 |
aacatgcattttcagtgtatgcctcctcaggaagtgaaatatatgatgagccactcaggcttgattctgaaaaaatttcatcagatgaagctattgattg |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
23917512 |
aacatgcattttcagtgtatgcctcctcaggaagtgaaatatatgatgagccactcaggcttgattctgaaaaaatttcatcagatgaggctattgattg |
23917413 |
T |
|
| Q |
129 |
agaaagtggaaaatagtcttcgaaattcgactgtagaaatttccgtggacgaagcaaaacaatgtctcttggaatgctatgagaatgtttttggtcaaca |
228 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||| |||||| |
|
|
| T |
23917412 |
agaaagcggaaaatagtcttcgaaattcgactgtagaaatttccgtggacgaagcaaaacaatgtctcttggaatactatgagaatttttttgatcaaca |
23917313 |
T |
|
| Q |
229 |
tcagtacctgagtccttccactgatccatctttatcttggtttcattgcttctggaactcactttcatctc |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
23917312 |
tcagtacctgagtccttccactgatccatccttaacttggtttcattgcttctggaactcactttcttctc |
23917242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University