View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1342_high_55 (Length: 270)
Name: NF1342_high_55
Description: NF1342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1342_high_55 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 48 - 241
Target Start/End: Complemental strand, 27935644 - 27935451
Alignment:
| Q |
48 |
agaaacaaatagaaagaactgaaggggagacataacaagagctatgagggttagcgaggtttccccctgttaatatgacaagatnnnnnnnttagttctc |
147 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
27935644 |
agaaacaaatagaaagaactaaagggaagacataacaagagctatgagggttagcgaggtttccccctgttaatatgacaagataaaaaaattagttctc |
27935545 |
T |
 |
| Q |
148 |
tcatttacaacacctctttctctgtttatatgtttttctgttgttatgacttatgagttgaaattatgaacggttgaactatggagggtctgtg |
241 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27935544 |
tcatttacgacacctctttctctgtttatatgtttttctgttgttatgacttatgagttgaaattatgaacggttgaactatggagggtttgtg |
27935451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University