View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1342_high_66 (Length: 250)
Name: NF1342_high_66
Description: NF1342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1342_high_66 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 8 - 223
Target Start/End: Original strand, 38359299 - 38359514
Alignment:
| Q |
8 |
tgggacataatgcaatcagacttgcaatgggctcaattcattagaagcaggattcttagaaacaaaaaaccagtcaattattatgtttcatcatctgttt |
107 |
Q |
| |
|
||||| || ||||||||||| || ||||||| ||| ||||||||||||||||| || || ||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
38359299 |
tgggatatcatgcaatcagatttacaatgggatcagttcattagaagcaggatcctaaggaacaaaaaaccagtcaattatcatgtttcgtcatctgttt |
38359398 |
T |
|
| Q |
108 |
ggagtggtgctagaaacaaattttccacagtgcttgacaatgtttcttggaacattggtaatggtgaaagagtaaatttctggactgattcatggtatgg |
207 |
Q |
| |
|
|||||||||||| | |||| || || ||||| || ||||| ||||| || ||||| ||||| |||| | || ||||||| |||||| |||| | | |
|
|
| T |
38359399 |
tgagtggtgctaggcataaatactctactgtgctagaaaatgtgtcttgaaatattggaaatggggaaaatattaacttctggattgattcctggtgtag |
38359498 |
T |
|
| Q |
208 |
agagcctctaacaact |
223 |
Q |
| |
|
||||||| | |||||| |
|
|
| T |
38359499 |
agagcctttgacaact |
38359514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 57; Significance: 7e-24; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 169 - 237
Target Start/End: Complemental strand, 18526174 - 18526106
Alignment:
| Q |
169 |
tggtgaaagagtaaatttctggactgattcatggtatggagagcctctaacaactactctcaatatccc |
237 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
18526174 |
tggtgaaagaataaatttctggactgattcatggtatggagatcctctaacaattactctcaatatccc |
18526106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 58
Target Start/End: Original strand, 16182587 - 16182640
Alignment:
| Q |
5 |
tgttgggacataatgcaatcagacttgcaatgggctcaattcattagaagcagg |
58 |
Q |
| |
|
||||||||||| ||||| |||||||| |||||||||||||| ||||||||||| |
|
|
| T |
16182587 |
tgttgggacatcatgcagtcagacttacaatgggctcaattagttagaagcagg |
16182640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University