View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1342_low_13 (Length: 545)
Name: NF1342_low_13
Description: NF1342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1342_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 2e-69; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 2e-69
Query Start/End: Original strand, 379 - 516
Target Start/End: Complemental strand, 196476 - 196339
Alignment:
| Q |
379 |
ccaaacatgcctaagatgtaggtaggggtgaagagagaacatggtcaaggcagagtacaatattcttttaatggaaatgaatgctgcaaatagaaatctt |
478 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
196476 |
ccaaacatgcctaagatgtaggtaggagtgaagagagaacatggtcaaggcagagtacaatattcttttaatggaaatgaatgctgcaaatagaaatctt |
196377 |
T |
 |
| Q |
479 |
agtacggtatacgatgattaatcatttaggggtgagtc |
516 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
196376 |
agtacggtatacgatgattaatcatttaggggtgagtc |
196339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 232 - 278
Target Start/End: Complemental strand, 196623 - 196577
Alignment:
| Q |
232 |
tgatagtcaaaattactaaacaaattcagtttgattgttttctttct |
278 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
196623 |
tgatagtcaaaattacgaaacaaattcagtttgattgttttctttct |
196577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 43 - 76
Target Start/End: Complemental strand, 29171749 - 29171716
Alignment:
| Q |
43 |
atttttatatttgacataattcatctttacaaaa |
76 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
29171749 |
atttttatatttgacataattcatctttccaaaa |
29171716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University