View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1342_low_23 (Length: 428)
Name: NF1342_low_23
Description: NF1342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1342_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 82 - 334
Target Start/End: Complemental strand, 13307388 - 13307137
Alignment:
| Q |
82 |
agagcatagatggagagattaatatgttaagctatggtgcatgaagactgtgttttggatctatttgaatgaaaaatcagataattttgcacgttattga |
181 |
Q |
| |
|
|||||||| |||||| || |||| ||||||||| ||||||||||||||||||||||||| | |||||||||||||||| |||||||||||| |||| ||| |
|
|
| T |
13307388 |
agagcatatatggagggaataatttgttaagctgtggtgcatgaagactgtgttttggacc-atttgaatgaaaaatcggataattttgcatgttaatga |
13307290 |
T |
 |
| Q |
182 |
agttcatctgaatacttgaactttacatcctttttggataatttctagagtttaacatcggtctgcactgattacaatatttcattactgttccttgaat |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13307289 |
agttcatctgaatacttgaactttacatcctttttggataatttctagagtttaacatcggtctgcactgattacaatatttcattactgttccttgaat |
13307190 |
T |
 |
| Q |
282 |
ttaatatgtttcactatatatttaaacagatcagtgcaggagcagtcatgctt |
334 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13307189 |
ttaatatgtttcactatgtatttaaacagattagtgcaggagcagtcatgctt |
13307137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University