View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1342_low_24 (Length: 413)
Name: NF1342_low_24
Description: NF1342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1342_low_24 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 218 - 413
Target Start/End: Original strand, 19190351 - 19190546
Alignment:
| Q |
218 |
atgggaataataacgagagcgggtatggaggtggacgttttggtggtggttatggttccgatgaccgttctggtggtggttatggcgctaatgaccgtta |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19190351 |
atgggaataataacgagagcgggtatggaggtggacgttttggtggtggttatggttccgatgaccgttctggtggtggttatggcgctaatgaccgtta |
19190450 |
T |
|
| Q |
318 |
tgagagtggatatgggcgttctgggggtggatatggtgatggagggcgtacgagtattggtggatatggcgaagaaaaccgttctagtggtggcta |
413 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19190451 |
tgagagtggatatgggcgttctggtggtggatatggtgatggagggcgttcgagtattggtggatatggcgaagaaaaccgttctagtggtggcta |
19190546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 141; E-Value: 8e-74
Query Start/End: Original strand, 13 - 153
Target Start/End: Original strand, 19190146 - 19190286
Alignment:
| Q |
13 |
tctggtggtgggtttggtggaaatggtggttattatggaaataaggataataagtatcatgagagtggttatggacgttatggtggtggtactacaggtg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19190146 |
tctggtggtgggtttggtggaaatggtggttattatggaaataaggataataagtatcatgagagtggttatggacgttatggtggtggtactacaggtg |
19190245 |
T |
|
| Q |
113 |
gtggttacggtcttgataaccgatctaacagtggttatgga |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19190246 |
gtggttacggtcttgataaccgatctaacagtggttatgga |
19190286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University