View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1342_low_32 (Length: 362)
Name: NF1342_low_32
Description: NF1342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1342_low_32 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 44 - 323
Target Start/End: Original strand, 37847046 - 37847325
Alignment:
| Q |
44 |
ggtatcatgtatttggggaacaaaatattgttaattcatgattaggaggttaaccaacatatatgaaaataaccaaatcttagcaaactacacaaatgga |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37847046 |
ggtatcatgtatttggggaacaaaatattgttaattcatgattaggaggttaaccaacatatatgaaaataaccaaatcttagcaaactacacaaatgga |
37847145 |
T |
 |
| Q |
144 |
tactagatataacagaaaatatatgacttaattttatctatctctgactttctcttgtaggattataagtagatatgaacagaactgaagctgtaccttt |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37847146 |
tactagatataacagaaaatatatgacttaattttatctatctctgactttctcttgtaggattataagtagatatgaacagaactgaagctgtaccttt |
37847245 |
T |
 |
| Q |
244 |
attcacattgcagattgatctttttcctgagaaattgttttgcacctgctcaaaagcaaaagtatcatttacaattttgt |
323 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37847246 |
attcgcattgcagattgatctttttcctgagaaattgttttgcacctgctcaaaagcaaaagtatcatttacaattttgt |
37847325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University