View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1342_low_43 (Length: 315)
Name: NF1342_low_43
Description: NF1342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1342_low_43 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 1e-81; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 5 - 174
Target Start/End: Original strand, 28267441 - 28267610
Alignment:
| Q |
5 |
cttattggtccacgtggcatccctcttaaaaccactagtggttttctactctgggtttcactccaccaactaaaagcagtttcatcactttccttatata |
104 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
28267441 |
cttattggtccacgtggtatccctctaaaaaccactagtggttttcttctctgggtttcactccaccaaccaaaagcagtttcatcactttccttatata |
28267540 |
T |
 |
| Q |
105 |
gctacacactgatgcgttttcagtcgctttgtctgttataacaaccaacgcgttcctcacccgtcgtaag |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28267541 |
gctacacactgatgcgttttcagtcgctttgtctgttataacaaccaacgcgttcctcacccgtcgtaag |
28267610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 57; Significance: 8e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 195 - 251
Target Start/End: Complemental strand, 10011424 - 10011368
Alignment:
| Q |
195 |
ttttttctgcaaaagatgaacacccctctttgttgtccaaatccaagctctgtggtg |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10011424 |
ttttttctgcaaaagatgaacacccctctttgttgtccaaatccaagctctgtggtg |
10011368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University