View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1342_low_46 (Length: 313)
Name: NF1342_low_46
Description: NF1342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1342_low_46 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 88 - 313
Target Start/End: Original strand, 28212290 - 28212514
Alignment:
| Q |
88 |
ttttcatccgtaatttgtgtctttaattcattttcttttagcattcatataaaacaatctccggtaagattcaactaaatagagatgaaaattatgagat |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28212290 |
ttttcatccgtaatttgtgtctttaattcattttcttttagcattcatataaa-caatctttggtaagattcaactaaatagagatgaaaattatgagat |
28212388 |
T |
 |
| Q |
188 |
acgattatcacataccgctcgaatgttccggttgttcctgtacttccatattcactccaaacgacatcccaatacctattaatccattgaggtcaacaat |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28212389 |
acgattatcacataccgctcgaatgttccggttgttcctgtacttccatattcactccaaacgacatcccaatacctattaatccattgaggtcaacaat |
28212488 |
T |
 |
| Q |
288 |
gttacaatatgttatggcttggatcc |
313 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
28212489 |
gttacaatatgttatggcttggatcc |
28212514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University