View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1342_low_50 (Length: 305)
Name: NF1342_low_50
Description: NF1342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1342_low_50 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 78 - 303
Target Start/End: Complemental strand, 29922803 - 29922578
Alignment:
| Q |
78 |
atctgagagggattacaatctcgttccataccctataagtcgtttactagataacccgtcattcacccttcttttagatgatccttacaatagtgtcact |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29922803 |
atctgagagggattacaatctcgttccataccctataagtcgtttactagataacccgtcattcacccttcttttagatgatccttacaatagtgtcact |
29922704 |
T |
 |
| Q |
178 |
tactatcatgtcaacaacgacatatgctctcgtataattggttcatgcaatggattgatctgtttggctgagacttctttaacccatgatgggtatcaag |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29922703 |
tactatcatgtcaacaacgacatatgctctcgtataattggttcatgcaatggattgatttgtttggctgagacttctttaacccatgatgggtatcaag |
29922604 |
T |
 |
| Q |
278 |
agaattggcgtagagagtattggttc |
303 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
29922603 |
agaattggcgtagagagtattggttc |
29922578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 201 - 247
Target Start/End: Original strand, 29880678 - 29880724
Alignment:
| Q |
201 |
atgctctcgtataattggttcatgcaatggattgatctgtttggctg |
247 |
Q |
| |
|
||||||||||||| ||||| | |||||||| |||||||||||||||| |
|
|
| T |
29880678 |
atgctctcgtatagttggtacctgcaatggtttgatctgtttggctg |
29880724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 204 - 247
Target Start/End: Original strand, 3625181 - 3625224
Alignment:
| Q |
204 |
ctctcgtataattggttcatgcaatggattgatctgtttggctg |
247 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||| |||||||||| |
|
|
| T |
3625181 |
ctctcgtatagttggttcctgcaatggattgatatgtttggctg |
3625224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University