View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1342_low_51 (Length: 299)
Name: NF1342_low_51
Description: NF1342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1342_low_51 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 30 - 299
Target Start/End: Complemental strand, 34374729 - 34374460
Alignment:
| Q |
30 |
atatcaaagactacatgcataacggtgaaaaatacatgtcatgaaattgattattaccttgttaattctcttatttgcgtttcctttatgaaagaatttg |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34374729 |
atatcaaagactacatgcataacggtgaaaaatacatgtcatgaaattgattattaccttgttaattctcttatttgcgtttcctttatgaaagaatttg |
34374630 |
T |
 |
| Q |
130 |
gacagaaaacgagtacaccctgcaggggggcaagttgacgagcttgagttgtttacttcaatattatcatcttctttattttttgaatgtgtgacattgt |
229 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34374629 |
gacagaaaaggagtacaccctgcaggggggcaagttgacgagtttgagttgtttacttcaatattatcatcttctttattttttgaatgtgtgacattgt |
34374530 |
T |
 |
| Q |
230 |
tgaggctgtcttgatttgcatggatatatgttggtgatagagatatcttcaacattggacaataatcaat |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34374529 |
tgaggctgtcttgatttgcatggatatatgttggtgatagagatatcttcaacattggacaatcatcaat |
34374460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University