View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1342_low_72 (Length: 257)
Name: NF1342_low_72
Description: NF1342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1342_low_72 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 33119966 - 33119722
Alignment:
| Q |
1 |
ccaaccatcctattttgcttggacatccttgtgtgtaccaatccctatgctgtgattcgcaacgctccttagacgcgtcatcttggattaagcatgcccc |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| || || |||||| |||| ||||||||||| ||||| |||||||||||| ||||||| |
|
|
| T |
33119966 |
ccaaccatcctatattgcttggacatccttgtgtgtaccaatctctgtgttgtgatgcgcagcgctccttagatgcgtcgtcttggattaagtatgcccc |
33119867 |
T |
|
| Q |
101 |
tggttttagctgcaaaaccaacattcgatacaagattatgtataaaagctcttaacaacaatgaatatat--aagagcataataaatttaaactactttg |
198 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||| ||||||||||||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33119866 |
cggttttagctgcaaacccaacatttgatacaagattatgtataagagctcttaacaacgatgaatatatacaagagcataataaatttaaactactttg |
33119767 |
T |
|
| Q |
199 |
tttaccctatcggtggaagcacagaagccacaatttgattcatct |
243 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33119766 |
tttaccttatcggtggaatcacagaagccacaatttgattcatct |
33119722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University